linearfold

package

v0.0.0-...-85e8820 Latest Latest Go to latest Published: Apr 2, 2024 License: MIT Imports: 8 Imported by: 0

Details

Valid go.mod file

The Go module system was introduced in Go 1.11 and is the official dependency management solution for Go.
Redistributable license

Redistributable licenses place minimal restrictions on how software can be used, modified, and redistributed.
Tagged version

Modules with tagged versions give importers more predictable builds.
Stable version

When a project reaches major version v1 it is considered stable.
Learn more about best practices

Repository

github.com/koeng101/dnadesign

Links

Open Source Insights

Documentation ¶

Index ¶

Constants
Variables
func BeamPrune(beamstep *map[int]*State) float64
func CONTRAfoldV2(sequence string, beamSize int) (string, float64)
func GET_ACGU_NUM(x rune) int
func Max(a, b int) int
func Min(a, b int) int
func NUM_TO_NUC(x int) int
func NUM_TO_PAIR(x, y int) (ret energy_params.BasePairType)
func Parse(sequence string, foldingModel FoldingModel) (string, float64)
func SET_HELIX_STACKING(x rune, y rune, z rune, w rune, val bool)
func ScoreExternalUnpaired(i, j int) float64
func ViennaRNAFold(sequence string, temperature float64, ...) (string, float64)
type CONTRAfoldV2FoldWrapper
- func NewDefaultCONTRAfoldV2FoldWrapper() CONTRAfoldV2FoldWrapper
- func (c CONTRAfoldV2FoldWrapper) Fold(sequence string, temp float64) (dotBracket string, score float64, err error)
type FoldingModel
type Pair
type PairHeap
- func (h PairHeap) Len() int
- func (h PairHeap) Less(i, j int) bool
- func (h *PairHeap) Pop() interface{}
- func (h *PairHeap) Push(x interface{})
- func (h PairHeap) Swap(i, j int)
type State
- func NewState() *State
- func (s *State) Set(score float64, manner int)
- func (s *State) Set2(score float64, manner int, l1 rune, l2 int)
- func (s *State) Set3(score float64, manner int, split int)
type Tuple
type ViennaRNAFoldWrapper
- func NewDefaultViennaRnaFoldWrapper() ViennaRNAFoldWrapper
- func (v ViennaRNAFoldWrapper) Fold(sequence string, temp float64) (dotBracket string, score float64, err error)

Constants ¶

View Source

const (
	MANNER_NONE                  = iota // 0: empty
	MANNER_H                            // 1: hairpin candidate
	MANNER_HAIRPIN                      // 2: hairpin
	MANNER_SINGLE                       // 3: single
	MANNER_HELIX                        // 4: helix
	MANNER_MULTI                        // 5: multi = ..M2. [30 restriction on the left and jump on the right]
	MANNER_MULTI_eq_MULTI_plus_U        // 6: multi = multi + U
	MANNER_P_eq_MULTI                   // 7: P = (multi)
	MANNER_M2_eq_M_plus_P               // 8: M2 = M + P
	MANNER_M_eq_M2                      // 9: M = M2
	MANNER_M_eq_M_plus_U                // 10: M = M + U
	MANNER_M_eq_P                       // 11: M = P
	/* MANNER_C_eq_U, */
	/* MANNER_C_eq_P, */
	MANNER_C_eq_C_plus_U // 12: C = C + U
	MANNER_C_eq_C_plus_P // 13: C = C + P
)

What is manner?

View Source

const (
	DefaultTemperature     = mfe.DefaultTemperature
	DefaultEnergyParamsSet = energy_params.Turner2004
)

View Source

const ASYMMETRY_MAX_LEN int = 28

View Source

const DefaultBeamSize int = 100

recommended beam size based on paper

View Source

const EXPLICIT_MAX_LEN int = 4

View Source

const HAIRPIN_MAX_LEN int = 30

View Source

const MIN_CUBE_PRUNING_SIZE int = 20

View Source

const NOTON int = 5 // NUM_OF_TYPE_OF_NUCS

View Source

const NOTOND int = 25

View Source

const NOTONT int = 125

View Source

const SINGLE_MAX_LEN int = 30 // NOTE: *must* <= sizeof(char), otherwise modify State::TraceInfo accordingly

View Source

const SINGLE_MIN_LEN int = 0

View Source

const SYMMETRIC_MAX_LEN int = 15

Variables ¶

View Source

var INTERNAL_MAX_LEN int = SINGLE_MAX_LEN

View Source

var VALUE_MIN float64 = -math.MaxFloat64

Functions ¶

func BeamPrune ¶

func BeamPrune(beamstep *map[int]*State) float64

func CONTRAfoldV2 ¶

func CONTRAfoldV2(sequence string, beamSize int) (string, float64)

Example ¶

result, score := CONTRAfoldV2("UGAGUUCUCGAUCUCUAAAAUCG", DefaultBeamSize)

fmt.Printf("result: %v , score: %v", result, score)

Output:

result: ....................... , score: -0.22376699999999988

func GET_ACGU_NUM ¶

func GET_ACGU_NUM(x rune) int

func Max ¶

func Max(a, b int) int

func Min ¶

func Min(a, b int) int

func NUM_TO_NUC ¶

func NUM_TO_NUC(x int) int

func NUM_TO_PAIR ¶

func NUM_TO_PAIR(x, y int) (ret energy_params.BasePairType)

func Parse ¶

func Parse(sequence string, foldingModel FoldingModel) (string, float64)

func SET_HELIX_STACKING ¶

func SET_HELIX_STACKING(x rune, y rune, z rune, w rune, val bool)

func ScoreExternalUnpaired ¶

func ScoreExternalUnpaired(i, j int) float64

func ViennaRNAFold ¶

func ViennaRNAFold(sequence string, temperature float64, energyParamsSet energy_params.EnergyParamsSet, danglingEndsModel mfe.DanglingEndsModel, beamSize int) (string, float64)

Example ¶

sequence := "UCUAGACUUUUCGAUAUCGCGAAAAAAAAU"
result, score := ViennaRNAFold(sequence, DefaultTemperature, DefaultEnergyParamsSet, mfe.DefaultDanglingEndsModel, DefaultBeamSize)
fmt.Printf("result: %v , score: %.2f", result, score)

Output:

result: .......((((((......))))))..... , score: -3.90

Types ¶

type CONTRAfoldV2FoldWrapper ¶

type CONTRAfoldV2FoldWrapper struct {
	BeamSize int
}

func NewDefaultCONTRAfoldV2FoldWrapper ¶

func NewDefaultCONTRAfoldV2FoldWrapper() CONTRAfoldV2FoldWrapper

func (CONTRAfoldV2FoldWrapper) Fold ¶

func (c CONTRAfoldV2FoldWrapper) Fold(sequence string, temp float64) (dotBracket string, score float64, err error)

type FoldingModel ¶

type FoldingModel int

const (
	CONTRAfoldv2 FoldingModel = iota // CONTRAfold v2.0 machine-learned model, Do et al 2006
	ViennaRNA                        // thermodynamic model, Lorenz et al 2011, with parameters from Mathews et al 2004
)

type Pair ¶

type Pair struct {
	// contains filtered or unexported fields
}

type PairHeap ¶

type PairHeap []Pair

func (PairHeap) Len ¶

func (h PairHeap) Len() int

func (PairHeap) Less ¶

func (h PairHeap) Less(i, j int) bool

func (*PairHeap) Pop ¶

func (h *PairHeap) Pop() interface{}

func (*PairHeap) Push ¶

func (h *PairHeap) Push(x interface{})

func (PairHeap) Swap ¶

func (h PairHeap) Swap(i, j int)

type State ¶

type State struct {
	// contains filtered or unexported fields
}

func NewState ¶

func NewState() *State

func (*State) Set ¶

func (s *State) Set(score float64, manner int)

func (*State) Set2 ¶

func (s *State) Set2(score float64, manner int, l1 rune, l2 int)

func (*State) Set3 ¶

func (s *State) Set3(score float64, manner int, split int)

type Tuple ¶

type Tuple struct {
	// contains filtered or unexported fields
}

type ViennaRNAFoldWrapper ¶

type ViennaRNAFoldWrapper struct {
	EnergyParamsSet   energy_params.EnergyParamsSet
	DanglingEndsModel mfe.DanglingEndsModel
	BeamSize          int
}

func NewDefaultViennaRnaFoldWrapper ¶

func NewDefaultViennaRnaFoldWrapper() ViennaRNAFoldWrapper

func (ViennaRNAFoldWrapper) Fold ¶

func (v ViennaRNAFoldWrapper) Fold(sequence string, temp float64) (dotBracket string, score float64, err error)

Source Files ¶

View all Source files

?	: This menu
/	: Search site
f or F	: Jump to
y or Y	: Canonical URL